View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18595_low_5 (Length: 238)
Name: NF18595_low_5
Description: NF18595
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18595_low_5 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 165; Significance: 2e-88; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 66 - 238
Target Start/End: Original strand, 3783364 - 3783536
Alignment:
| Q |
66 |
gacaaaggttgcggtggtggtacaatgacagtaatgggtatgtggttttgtgatgatgaagatcaagttattatgtggtggctcaatgatgaaggattta |
165 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3783364 |
gacaaaggttgcggtggtggtacaatgacagtactgggtatgtggttttgtgatgatgaagatcaagttattatgtggtggctcaatgatgaaggattta |
3783463 |
T |
|
| Q |
166 |
acaagtgattagtttgtcgtcacgtaatgaaagtacaataatgtttgtatccatagagaatgcgtgatttcaa |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
3783464 |
acaagtgattagtttgtcgtcacgtaatgaaagtacaataatgtttgtatccatagagattgcgtgatttcaa |
3783536 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 18 - 47
Target Start/End: Original strand, 3783343 - 3783372
Alignment:
| Q |
18 |
ccaaaaacctcataaccgctagacaaaggt |
47 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
3783343 |
ccaaaaacctcataaccgctagacaaaggt |
3783372 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University