View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18596_low_14 (Length: 251)
Name: NF18596_low_14
Description: NF18596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18596_low_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 15 - 218
Target Start/End: Complemental strand, 5067448 - 5067246
Alignment:
| Q |
15 |
caaaggtcaaggtaaaaatcataaacaacttcacatgnnnnnnnnnnnnnnnnnccatcatcatcatttgattggttactttggtgcatgtgttctataa |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5067448 |
caaaggtcaaggtaaaaatcataaacaacttcacatgttttttgttttgtttttccatcatcatcatttgattggttactttggtgcatgtgttctataa |
5067349 |
T |
 |
| Q |
115 |
agtctaatgttcctatgttcatgtttcttgttagtggagtggtttttatgtacttggttttttagactattccattggtttcattttcttcatattttct |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5067348 |
-gtctaatgttcctatgttcatgtttcttgttagtggagtggtttttatgtacttggttttttagactattccattggtttcattttcttcatattttct |
5067250 |
T |
 |
| Q |
215 |
tgat |
218 |
Q |
| |
|
|||| |
|
|
| T |
5067249 |
tgat |
5067246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University