View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18596_low_15 (Length: 239)
Name: NF18596_low_15
Description: NF18596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18596_low_15 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 13896987 - 13897225
Alignment:
| Q |
1 |
atgaagtgtagtcgctggagttcctaaatatattgaagttacaaaattggtgtatctttt-gtcatactaataaatgaaagactcattcgagaactaaac |
99 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||||||| ||| ||||||| ||||| |||| |||||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
13896987 |
atgaagtgtagtcgccggagttcctaaatgtattgaaattataaaattgatgtatttttttgtcatactaacaaatgaaagactcattcgagaattaaac |
13897086 |
T |
 |
| Q |
100 |
tgactaacgaaagtcatatctagatgtgnnnnnnnnataattttgatacattcaccaactattatgactctgcctcaaacgcgtttaagaatcaaaatga |
199 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
13897087 |
tgactaacgaaagtcatatctagatgtgttttttt-ataattttgatacattcaccgactattgtgactctgcctcaaacgcgtttaagaatcaaaatga |
13897185 |
T |
 |
| Q |
200 |
ttgtttactctgcatcaatcacttgtgcccggcagcgcct |
239 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
13897186 |
ttgtttactctgcatcaatcacttgcgcccggcagcgcct |
13897225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University