View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18596_low_9 (Length: 317)
Name: NF18596_low_9
Description: NF18596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18596_low_9 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 21 - 317
Target Start/End: Complemental strand, 29405437 - 29405132
Alignment:
| Q |
21 |
gaaaaatcttcctcatcacttaatatataccttgacccttccaaccccatctctctatcagtctcccctaacaaatccatcaacgacatcgtcggaggtc |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29405437 |
gaaaaatcttcctcatcacttaatatataccttgacccttccaaccccatctctctatcagtctcccctaacaaatccatcaacgacatcgtcggaggtc |
29405338 |
T |
|
| Q |
121 |
ctg---cagcctcggcctcagcctc------cgctgcagcttctgctgcttcttgtgccgccactgcttctctcgccgataatgccctccccgtctctgg |
211 |
Q |
| |
|
||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29405337 |
ctgttgcagcctcggcctcagcctcagcctccgctgcagcttctgctgcttcttgtgccgccactgcttctctcgccgataatgccctccccgtctctgg |
29405238 |
T |
|
| Q |
212 |
atgcttggtatcatcgtcgggctcctcatcgtcgaagctgtctcgaaaagtcactacacgcccttttcggaatggatctgccgatgacacgttggtggaa |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29405237 |
atgcttggtatcatcgtcgggctcctcatcgtcgaagctgtctcgaaaagtcactacacgcccttttcggaatggatctgccgatgacacgttggtggaa |
29405138 |
T |
|
| Q |
312 |
ttcttg |
317 |
Q |
| |
|
|||||| |
|
|
| T |
29405137 |
ttcttg |
29405132 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 27 - 86
Target Start/End: Original strand, 19911363 - 19911422
Alignment:
| Q |
27 |
tcttcctcatcacttaatatataccttgacccttccaaccccatctctctatcagtctcc |
86 |
Q |
| |
|
||||| |||||||| || |||||||||| |||||||| |||||||| |||||||||||| |
|
|
| T |
19911363 |
tcttcttcatcactcaaagtataccttgatccttccaatcccatctccctatcagtctcc |
19911422 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University