View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18597_high_34 (Length: 219)
Name: NF18597_high_34
Description: NF18597
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18597_high_34 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 15 - 210
Target Start/End: Complemental strand, 12448546 - 12448347
Alignment:
| Q |
15 |
aatataaaacgattatttgagttactctttcgtttaaatacaaattttattttattcagaagtacctattagaactatgacttatgaaa----agccaca |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
12448546 |
aatataaaacgattatttgagttactctttcgcttaactacaaattttattttattcagaagtacctattagaactatgacttatgaaagttaagccaca |
12448447 |
T |
 |
| Q |
111 |
ccacccaattatgaatggtcggagacatcaaaataaggaagttcttgatgtaaagtctgcatttctcaatgtcaaacttaaggatgaagtatatgatgat |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
12448446 |
ccacccaattatgaatggtcggagacatcaaaataaggaagctcttgatgtaaagtctgcatttctcaatgtcaaacttaaggatgaagtatatgttgat |
12448347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 205
Target Start/End: Complemental strand, 55369774 - 55369726
Alignment:
| Q |
157 |
gatgtaaagtctgcatttctcaatgtcaaacttaaggatgaagtatatg |
205 |
Q |
| |
|
||||| |||| ||| |||||||||| || |||||||||||||||||||| |
|
|
| T |
55369774 |
gatgtcaagtttgcgtttctcaatggcagacttaaggatgaagtatatg |
55369726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University