View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18597_high_37 (Length: 205)
Name: NF18597_high_37
Description: NF18597
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18597_high_37 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 12 - 186
Target Start/End: Complemental strand, 14574951 - 14574776
Alignment:
| Q |
12 |
agaatattggagtgatgttgaggtttttgatatggcgaatgcattgcggttgagaaatgttttgaacattgaatcaagatgcacccgatgagtttgt-tt |
110 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| || |
|
|
| T |
14574951 |
agaatattggagtgctgttgaggtttttgatatggcgaaagcattgcggttgagaaatgttttgaacattgaatcaagatgcaaccgatgagtttgtatt |
14574852 |
T |
|
| Q |
111 |
gaaatgtagggtttttgtgaaagaagatgattcaactcaactgggttcgtgcggatacaactgaactcagagatgt |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||| |||||| ||||||| ||||||||| |
|
|
| T |
14574851 |
gaaatgtagggtttttgtgaaagaagatgattcaactcaaatgggttcgtgtggataccactgaacacagagatgt |
14574776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University