View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18597_low_11 (Length: 437)
Name: NF18597_low_11
Description: NF18597
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18597_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 389; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 389; E-Value: 0
Query Start/End: Original strand, 18 - 429
Target Start/End: Original strand, 52807205 - 52807619
Alignment:
| Q |
18 |
acacatagctctggctgctcttccaatagcaatatcgaaacttccacaatcgcatgagtttgtcataaaacacaacttccacgtcattgccacaaaccaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52807205 |
acacatagctctggctgctcttccaatagcaatatcgaaacttccacaatcgcatgagtttgtcataaaacacaacttccacgtcattgccacaaaccaa |
52807304 |
T |
|
| Q |
118 |
aggaaaataggtaactgcatgttttttcgggacgacaagcctattgagtttaccaacatcacttggtgttaattctttttgaaaaagtagttgtgtgcaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52807305 |
aggaaaataggtaactgcatgttttttcgggacgacaagcctattgagtttaccaacatcacttggtgttaattctttttgaaaaagtagttgtgtgcaa |
52807404 |
T |
|
| Q |
218 |
gaaaattgttcctcacccttcacccctataacaacaccttctttgcctgcaccttgg---ctttcattatttctaagaaatgttgttgcaaaattagagg |
314 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52807405 |
gaaaattgttcctcatccttcacccctataacaacaccttctttgcctgcaccttggcgcctttcattatttctaagaaatgttgttgcaaaattagagg |
52807504 |
T |
|
| Q |
315 |
ggtatgttccatttctaatcatgatcataattgtttccatgttatattgactttgaaacataggttcttcaactgtttggttattccatgcaaagtttct |
414 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
52807505 |
ggtatgttccatttctaatcatgatcataattgtttccatgctatattgactttgaaacataggttcttgaactgtttggttattccatgcaaagtttct |
52807604 |
T |
|
| Q |
415 |
atggctttctctgct |
429 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
52807605 |
atggctttctctgct |
52807619 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University