View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18597_low_17 (Length: 407)
Name: NF18597_low_17
Description: NF18597
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18597_low_17 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 283; Significance: 1e-158; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 12 - 330
Target Start/End: Complemental strand, 23332913 - 23332595
Alignment:
| Q |
12 |
gaatatggtgtgcatgttgatgattatgtcatgttgcgtgatccaaacagaaacatgttcgaggccaaggtccacgtgaaaaatggcaaggtctatctgc |
111 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||| ||||||| |
|
|
| T |
23332913 |
gaatatggtttgcatgttgatgattatgtcatgttgcgtgatccaaacagaaacatgttcaaggtcaaggtccacgtgaaaaatggcaaggtttatctgc |
23332814 |
T |
|
| Q |
112 |
gggatggttgggctgagctgaagggtttctataaggtagatcgtggtgcgtgggtcaccctgacttatgtacagccgaatcttctagatatgactgtcgc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
23332813 |
gggatggttgggctgagctgaagggtttctataaggtagatcgtggtgcgtgggtcaccctgacgtatgtacagccgaatcttctagatatgactatcgc |
23332714 |
T |
|
| Q |
212 |
agagagatcaggagtcgaaatcaactatcctaacaaatttcttcctcccatgtcgaaaatgattgtccaacgtgagggtggatcggacatgcgcttctat |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
23332713 |
agagagatcaggagtcgaaatcaactatcctaacaaatttcttcctcccatgtcgaaaatgattgtcccacgtgagggtggatcggtcatgcgcttctat |
23332614 |
T |
|
| Q |
312 |
cgctcattcgtccacatat |
330 |
Q |
| |
|
|||||||||||||| |||| |
|
|
| T |
23332613 |
cgctcattcgtccatatat |
23332595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 325 - 401
Target Start/End: Complemental strand, 23322373 - 23322297
Alignment:
| Q |
325 |
acatatgcgtttggattttacaacgattgtgtttggtgatgtcagtctgaattgtctataaaaaacacaggttctgc |
401 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23322373 |
acatatgcgtttggagtttacaacgtttgtgtttggtgatgtcagtctgaattgtctataaaaaacacaggttctgc |
23322297 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 325 - 401
Target Start/End: Complemental strand, 23332540 - 23332464
Alignment:
| Q |
325 |
acatatgcgtttggattttacaacgattgtgtttggtgatgtcagtctgaattgtctataaaaaacacaggttctgc |
401 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23332540 |
acatatgcgtttggagtttacaacgtttgtgtttggtgatgtcagtctgaattgtctataaaaaacacaggttctgc |
23332464 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 12 - 103
Target Start/End: Original strand, 10955077 - 10955166
Alignment:
| Q |
12 |
gaatatggtgtgcatgttgatgattatgtcatgttgcgtgatccaaacagaaacatgttcgaggccaaggtccacgtgaaaaatggcaaggt |
103 |
Q |
| |
|
||||||||| |||| |||||||| |||||||| |||||||||| |||| ||||||||||||| ||||||||| ||| || |||||||| |
|
|
| T |
10955077 |
gaatatggtttgcacgttgatgactatgtcat--tgcgtgatcctaacaagaacatgttcgaggttaaggtccacaagaagaagggcaaggt |
10955166 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University