View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18597_low_20 (Length: 366)
Name: NF18597_low_20
Description: NF18597
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18597_low_20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 154; Significance: 1e-81; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 44 - 214
Target Start/End: Complemental strand, 37788331 - 37788159
Alignment:
| Q |
44 |
gagtaattactagcaaattagtcattgagatggttaaacatgaaatgccacatgtgc--gtagtattcattttgcaattttagaaaaaacattttccaat |
141 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37788331 |
gagtaattactagcaaattagtcattaagatggttaaacatgaaatgccacatgtgcttgtagtattcattttgcaattttagaaaaaacattttccaat |
37788232 |
T |
|
| Q |
142 |
ttgtagaaatgagagactattttgatggatcctattcaatctacttttgagcctctatcaaatcgagattgtt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
37788231 |
ttgtagaaatgagagactattttgatggatcctattcaatctacttttgagcctctatcaaatctagattgtt |
37788159 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 213 - 348
Target Start/End: Complemental strand, 37787863 - 37787728
Alignment:
| Q |
213 |
ttgtcacatgcacatatataagnnnnnnntaaagaacatcaaaactcttgtgacacattaaatgtggtaataaagtaactttatttacatttctaataaa |
312 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
37787863 |
ttgtcacatgcacatatataagaaaaaaataaagaacatcaaaactcatgtgacacattaaatgtggtaataaagtaactttatttacatttctattaaa |
37787764 |
T |
|
| Q |
313 |
taaagggaacttctatggtagtttcttacccctagt |
348 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
37787763 |
taaagggaacttctatggtagtttcttacccctagt |
37787728 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 37788698 - 37788654
Alignment:
| Q |
1 |
tgttgttgcagggacttttttgttggtaattgcaactatttaaga |
45 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37788698 |
tgttgttgcagggacttttttgttggtaattgcaactatttaaga |
37788654 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University