View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18597_low_29 (Length: 268)
Name: NF18597_low_29
Description: NF18597
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18597_low_29 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 248
Target Start/End: Original strand, 23099031 - 23099278
Alignment:
| Q |
1 |
atccttcccacaattaattcacctatttcttgttcctcttcaaatttcttttctttaaccatccaaatattcaatcttttcctctctccgatactaaaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23099031 |
atccttcccacaattaattcacctatttcttgttcctcttcaaatttcttttctttaaccatccaaatattcaatcttttcctctctccgatactaaaat |
23099130 |
T |
|
| Q |
101 |
caannnnnnngtttggattttcttaaatttcataaagatcatattttttatgtttccatgctaaggaatgagagaaatcaactaaaacaaagaggagcaa |
200 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23099131 |
caatttttttatttggattttcttaaatttcataaagatcatattttttatgtttccatgctaaggaatgagagaaatcaactaaaacaaagaggagcaa |
23099230 |
T |
|
| Q |
201 |
gaaataggtgaatcggtttgggtatgctagaagaatgaatttgattgt |
248 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
23099231 |
gaaataggtgaatcggtttgggtatgctataagaatgaatttgattgt |
23099278 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University