View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18597_low_45 (Length: 219)
Name: NF18597_low_45
Description: NF18597
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18597_low_45 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 201
Target Start/End: Complemental strand, 7175322 - 7175122
Alignment:
| Q |
1 |
atttcaaatttcaatgtttgagtgattgggagtgtggcatgcacaaaaagagccaaataaggactttcaaatacgttgtttcacataatatcgaaaggat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
7175322 |
atttcaaatttcaatgtttgagtgattgggagtgtggcatgcacaaaaagagccaaataaggactttcaaatatgttgtttcacataatatcgaaaggat |
7175223 |
T |
|
| Q |
101 |
tttcgaatatgttgtttcacataatgtcaagggattacatatcgacatccaatgtgatatcaactactttccaccaagcttcttttcatgtcacacttta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
7175222 |
tttcgaatatgttgtttcacataatgtcaagggattacatatcgacatccaatgtgatatcaactactttccgccaagcttcttttcatgtcacacttta |
7175123 |
T |
|
| Q |
201 |
a |
201 |
Q |
| |
|
| |
|
|
| T |
7175122 |
a |
7175122 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 201
Target Start/End: Complemental strand, 7104107 - 7104014
Alignment:
| Q |
108 |
tatgttgtttcacataatgtcaagggattacatatcgacatccaatgtgata-tcaactactttccaccaagcttcttttcatgtcacactttaa |
201 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||| | || ||||||||| ||||| ||||||| || |||| ||||| ||||||||||||| |
|
|
| T |
7104107 |
tatgttgtttcacataatgtcaagagattacgaatccatgtcaaatgtgatattcaac-actttccgtcatgcttgttttcttgtcacactttaa |
7104014 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University