View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18598_high_31 (Length: 277)
Name: NF18598_high_31
Description: NF18598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18598_high_31 |
 |  |
|
| [»] scaffold0007 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0007 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 19 - 267
Target Start/End: Original strand, 203331 - 203578
Alignment:
| Q |
19 |
actctatctcttcctcccattattattatttaaattaaagagaacctaatcatttccacttagttttatttcacaagtgacttaagaaccttatgcaaaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
203331 |
actctatctcttcctcccattattattatttaaatcaaagagaacctaatcatttccacttagttttatttcacaagtgacttaagaaccttatgcaaaa |
203430 |
T |
 |
| Q |
119 |
cgtggtttttcactgtttctttagcggctaaatataaagtattaaatacgattaattttatctggtcaattgtatgtcatcgctgtaaagctaatatatt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
203431 |
cgtggtttttcactgtttctttagcggctaaatataaagtattaaatacgattaattttatctggtcaattgtatgtcatcgctgtaaagctaatatatt |
203530 |
T |
 |
| Q |
219 |
cnnnnnnnctgaaagactttttcaaaatatatttgtctcttctcctatg |
267 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
203531 |
c-aaaaaactgaaagactttttcaaaatatatttgtctcttctcctatg |
203578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University