View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18598_high_33 (Length: 251)
Name: NF18598_high_33
Description: NF18598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18598_high_33 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 88 - 223
Target Start/End: Original strand, 4623501 - 4623640
Alignment:
| Q |
88 |
atcaatgaaaatttcttttcttgaaatgggtcattgtgaattcttgagaaaagnnnnnnnnnnnnnn----atgtgggttggttgatttggttttcttat |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||| ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
4623501 |
atcaatgaaaatttcttttcttgaaatgggtcattgtgaatttttgaaaaaagtttttatttttattttttatgtgggttggttgatttggttttcttat |
4623600 |
T |
|
| Q |
184 |
gcttatgttgaaaatttggtcaaattttgtgttaaggtgg |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4623601 |
gcttatgttgaaaatttggtcaaattttgtgttaaggtgg |
4623640 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University