View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18598_high_42 (Length: 224)

Name: NF18598_high_42
Description: NF18598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18598_high_42
NF18598_high_42
[»] chr3 (1 HSPs)
chr3 (13-208)||(32644542-32644737)


Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 13 - 208
Target Start/End: Original strand, 32644542 - 32644737
Alignment:
13 aatatcaattttgggatcatctattgcagtaattggcattgattttgtctccccttcaatggttgatgatggtaatttggtgtctgatttagaatagtct 112  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||    
32644542 aatatcaattttgggatcatctattgcagtaattggcattgattttgtctccccttcaatggttgatgatggtaatttggtgtctgattctgaatagtct 32644641  T
113 ttggcttttccccacacaactgtataaaggcctagtgcaatgataacagctccaataatactgcaatgaattgaaaacataaattacataaaatat 208  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
32644642 ttggcttttccccacacaactgtataaaggcctagtgcaatgataacagctccaatcatactgcaatgaattgaaaacataaattacataaaatat 32644737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University