View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18598_low_39 (Length: 251)

Name: NF18598_low_39
Description: NF18598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18598_low_39
NF18598_low_39
[»] chr7 (1 HSPs)
chr7 (88-223)||(4623501-4623640)


Alignment Details
Target: chr7 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 88 - 223
Target Start/End: Original strand, 4623501 - 4623640
Alignment:
88 atcaatgaaaatttcttttcttgaaatgggtcattgtgaattcttgagaaaagnnnnnnnnnnnnnn----atgtgggttggttgatttggttttcttat 183  Q
    |||||||||||||||||||||||||||||||||||||||||| |||| |||||                  |||||||||||||||||||||||||||||    
4623501 atcaatgaaaatttcttttcttgaaatgggtcattgtgaatttttgaaaaaagtttttatttttattttttatgtgggttggttgatttggttttcttat 4623600  T
184 gcttatgttgaaaatttggtcaaattttgtgttaaggtgg 223  Q
    ||||||||||||||||||||||||||||||||||||||||    
4623601 gcttatgttgaaaatttggtcaaattttgtgttaaggtgg 4623640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University