View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18598_low_44 (Length: 239)
Name: NF18598_low_44
Description: NF18598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18598_low_44 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 18 - 239
Target Start/End: Original strand, 8887791 - 8888012
Alignment:
| Q |
18 |
atggatcacctttgaacattttttgaagttcatattattagactaaacannnnnnnaatacggaaccacttatgaatttatttttcttagtttcaaattt |
117 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8887791 |
atggatcacctttgaacattttttaaagttcatatttttagactaaacatttttttaatacggaaccacttatgaatttatttttcttagtttcaaattt |
8887890 |
T |
|
| Q |
118 |
ttgttgataattcatttaactttagtggtgacttttgctagataatattttttgttgttgtatatgattatatatgaagaatgaccttgacaaaatatga |
217 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
8887891 |
ttgttgataattcatttaactttggtggtgacttttgctagataatattttttgttgttgtatatgattatatatgaagaataaccttgacaaaatatga |
8887990 |
T |
|
| Q |
218 |
tttgattttcagagatgagatc |
239 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
8887991 |
tttgattttcagagatgagatc |
8888012 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University