View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18598_low_47 (Length: 228)

Name: NF18598_low_47
Description: NF18598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18598_low_47
NF18598_low_47
[»] chr8 (1 HSPs)
chr8 (9-213)||(43887053-43887256)


Alignment Details
Target: chr8 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 9 - 213
Target Start/End: Original strand, 43887053 - 43887256
Alignment:
9 aatttgtttcataggaaaatattagcactaagataaatatgaagattgcataaaaaagtaaaacacacacacatgtatataaaggatgtgaaaattgata 108  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
43887053 aatttgtttcataggaaaatattagcagtaagataaatatgaagattgcataaaa-agtaaaacacacacacatgtatataaaggatgtgaaaattgata 43887151  T
109 taggaattaaccttgggatggatgatttcaagaagttctgccccaactcctgaatcttcaatttcagattggtagctgattttcaagaaacaaaatagta 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43887152 taggaattaaccttgggatggatgatttcaagaagttctgccccaactcctgaatcttcaatttcagattggtagctgattttcaagaaacaaaatagta 43887251  T
209 agaaa 213  Q
    |||||    
43887252 agaaa 43887256  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University