View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18598_low_48 (Length: 224)
Name: NF18598_low_48
Description: NF18598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18598_low_48 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 13 - 208
Target Start/End: Original strand, 32644542 - 32644737
Alignment:
| Q |
13 |
aatatcaattttgggatcatctattgcagtaattggcattgattttgtctccccttcaatggttgatgatggtaatttggtgtctgatttagaatagtct |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
32644542 |
aatatcaattttgggatcatctattgcagtaattggcattgattttgtctccccttcaatggttgatgatggtaatttggtgtctgattctgaatagtct |
32644641 |
T |
 |
| Q |
113 |
ttggcttttccccacacaactgtataaaggcctagtgcaatgataacagctccaataatactgcaatgaattgaaaacataaattacataaaatat |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32644642 |
ttggcttttccccacacaactgtataaaggcctagtgcaatgataacagctccaatcatactgcaatgaattgaaaacataaattacataaaatat |
32644737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University