View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18599_high_15 (Length: 375)
Name: NF18599_high_15
Description: NF18599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18599_high_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 322; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 322; E-Value: 0
Query Start/End: Original strand, 20 - 361
Target Start/End: Complemental strand, 45383621 - 45383281
Alignment:
| Q |
20 |
taatgaagtctactacagaggcgcatggtaggacaccgtactgctagcatgtctgagtgtatccgtccaacaatcaatcagcacacacataatcaacata |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
45383621 |
taatgaagtctactacagaggcgcatggtaggacaccatactgctagcatgtctgagtgtatccgtccaacaatcaatcagcacgcacataatcaacata |
45383522 |
T |
 |
| Q |
120 |
agatgttgttccgcgaaccatgcagagaatctctcaacggcctcaacgaaattttgctcaattctcttgaaactctacctataaaaggacacctcagcta |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45383521 |
agatgttgttccgcgaaccatgcagagaatctctcaacggcctcaacgaatttttgctcaattctcttgaaactctacctataaaaggacacctcagcta |
45383422 |
T |
 |
| Q |
220 |
ggataaacatacacattccattatgttaaacgtctcatgcaccgcactcaaaaactgacttgagcgtttagtgtttgcatatacaacacccctgccaaag |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
45383421 |
ggataaacatacacattccattatgttaaacgtctcatgcaccgcactcaaaaactgacttgagcg-ttagtgtttgcatatacaacacccctgccaaag |
45383323 |
T |
 |
| Q |
320 |
agctcagccatcgtcctcagttgcgtttcatcaaccgaccat |
361 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45383322 |
agctcagccatcgtcctcagttgcgtttcatcaaccgaccat |
45383281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University