View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18599_high_25 (Length: 298)
Name: NF18599_high_25
Description: NF18599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18599_high_25 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 153 - 294
Target Start/End: Complemental strand, 45158020 - 45157879
Alignment:
| Q |
153 |
gtgaaggaaatgagaaatcccctgcatggaagaagataggtaccaaagagcttggaattcacaattcgtccattggacccgctgcccggaaggttctaaa |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45158020 |
gtgaaggaaatgagaaatcccctgcatggaagaagataggtaccaaagagcttggaattcacaattcgtccattggacccgctgcccggaaggttctaaa |
45157921 |
T |
 |
| Q |
253 |
tgggctcaagaaaaggggtacatattattgttcatctcactc |
294 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| | |||||| |
|
|
| T |
45157920 |
tgggctcaagaaaaggggtacgtattattgttcttatcactc |
45157879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 1 - 73
Target Start/End: Complemental strand, 45158172 - 45158100
Alignment:
| Q |
1 |
tgtctcaattcgtgaagaaggcaagtgaaagcactcaacttaactcaattgttagtggtgaagaaatcaaggg |
73 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45158172 |
tgtctcaattcgtgaagaaggcaagtgaaagcactcaacttaactcaattgttagtggtgaagaaatcaaggg |
45158100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University