View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18599_high_33 (Length: 252)

Name: NF18599_high_33
Description: NF18599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18599_high_33
NF18599_high_33
[»] chr4 (2 HSPs)
chr4 (105-205)||(37606636-37606737)
chr4 (206-252)||(37606558-37606606)


Alignment Details
Target: chr4 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 105 - 205
Target Start/End: Complemental strand, 37606737 - 37606636
Alignment:
105 aagtatttcattatcctgatttttcatacattattagcttcttcctccttctaaattttgtgactaaatttcttgtatt-aaaataggttcggaaacagc 203  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||    
37606737 aagtatttcattatcctgatttttcatacattattagcttcttcctccttctaaagtttgtgactaaatttcttgtattaaaaataggttcggaaacagc 37606638  T
204 ct 205  Q
    ||    
37606637 ct 37606636  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 252
Target Start/End: Complemental strand, 37606606 - 37606558
Alignment:
206 cttttgcttgcatgcacaaagtgaatgt--gtgtcgaatccattaattc 252  Q
    ||||||||||||||||||||||||||||  |||||||||||||||||||    
37606606 cttttgcttgcatgcacaaagtgaatgtgtgtgtcgaatccattaattc 37606558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University