View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18599_high_37 (Length: 247)
Name: NF18599_high_37
Description: NF18599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18599_high_37 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 159; Significance: 9e-85; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 89 - 247
Target Start/End: Original strand, 33892182 - 33892340
Alignment:
| Q |
89 |
atccccatataatttagttctcgtttaaaaataatcaaaattcatcttaagaaatgaattgttgatgagccaagggcaaccaaaattcatgaatgtgcat |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33892182 |
atccccatataatttagttctcgtttaaaaataatcaaaattcatcttaagaaatgaattgttgatgagccaagggcaaccaaaattcatgaatgtgcat |
33892281 |
T |
 |
| Q |
189 |
tttgagaaactttgtacaatgttcaattatataaccaattgctaaaccatcatggtgaa |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33892282 |
tttgagaaactttgtacaatgttcaattatataaccaattgctaaaccatcatggtgaa |
33892340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 8 - 86
Target Start/End: Original strand, 33891958 - 33892036
Alignment:
| Q |
8 |
agagtattcctggtgggtgctcacttttaaacaatgcaacacttgttgggttgatctctgcatataggaatgtcgattt |
86 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33891958 |
agagtattcctggtgggtgctcacttttaaacaatgcaacacttgttgggttgatctctgcatataggaatgtcgattt |
33892036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University