View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18599_high_51 (Length: 208)
Name: NF18599_high_51
Description: NF18599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18599_high_51 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 1 - 190
Target Start/End: Original strand, 1554419 - 1554608
Alignment:
| Q |
1 |
cgaaatagaagttacttgatcacttcaaagtagctgaacaatcaaactaaagcagtaagcatgatattgcagaagatcactgtaatgtcatgctttaaca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
1554419 |
cgaaatagaagttacttgatcacttcaaagtagctgaacaatcaaactaaagcagtaagcatgatattgcagaagatcactgtaatgtcatgctttagca |
1554518 |
T |
 |
| Q |
101 |
acaatgaaataaagaatcgcatccttagtataataaagtttattggacttaaaaaccaatattctacagaggaaaactagttgacccttt |
190 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
1554519 |
acaatgaaataaagaatcacatccttagtataataaagtttattggacttaaaaaccaatatcctacagaggaaaactagttaacccttt |
1554608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University