View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18599_high_52 (Length: 201)
Name: NF18599_high_52
Description: NF18599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18599_high_52 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 17 - 189
Target Start/End: Original strand, 42669494 - 42669666
Alignment:
| Q |
17 |
aagctttgaactgattgtagtcttatctgactcgagagattaatattagagtttagacggaagccggtctgaatctctgcctacaagaatgacaggtaat |
116 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
42669494 |
aagctttgaactgattgcagtcttatctgactcgagagattaatattagagtttagacggaagctggtctgaatctctgcctacaagaatgacaggtaat |
42669593 |
T |
 |
| Q |
117 |
ctccatacaagcggaatcaacctgtctcgttgctctttctttgatcctctcagctctttcaacttcttctctc |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42669594 |
ctccatacaagcggaatcaacctgtctcgttgctctttctttgatcctctcagctctttcaacttcttctctc |
42669666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University