View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18599_low_15 (Length: 380)
Name: NF18599_low_15
Description: NF18599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18599_low_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 325; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 325; E-Value: 0
Query Start/End: Original strand, 1 - 366
Target Start/End: Original strand, 46072373 - 46072738
Alignment:
| Q |
1 |
taaagttgcatcttcttcatttcatccgacaccttgagcacaaaatggttaaccaaacgagttataagaacccnnnnnnntcaatgcaattcatctatgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
46072373 |
taaagttgcatcttcttcatttcatctgacaccttgagcacaaaatggttaaccaaacgagttataagaacccaaaaaaatcaatgcaattcatctatgt |
46072472 |
T |
 |
| Q |
101 |
ccttgtttatctgctgcaggcaaaggaagatcaattttctaaacattacactaactccttgtggcttttttggtatatatacaaatgtagccgaaaaggg |
200 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
46072473 |
ccctgtttatctgctgcaggcaaaggaagatcaattttctaaacattacactaactccttgtggcctttttggtatatatacaaatgtagccgaaaaggg |
46072572 |
T |
 |
| Q |
201 |
taacaaacggatattaatcagcgtctgttgttctctttttcctcctgtgttcttttctgccgtggccttcttctatcttcacacacttcaggctccttac |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46072573 |
taacaaacggatattaatcagcgtctgttgttctctttttcctcctgtgttcttttctgccgtggccttcttctatcttcacacacttcaggctccttac |
46072672 |
T |
 |
| Q |
301 |
tgacagattcatcagacttacctgcagcgttcctgtcccaaaatggcacgccaccattcgatgatg |
366 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
46072673 |
tgacagattcatcagacttaccagcagcgttcctgtcccaaaatggcacgccaccattcaatgatg |
46072738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University