View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18599_low_18 (Length: 350)
Name: NF18599_low_18
Description: NF18599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18599_low_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 10 - 332
Target Start/End: Complemental strand, 19603216 - 19602905
Alignment:
| Q |
10 |
attattctctgtggttttaatttcaattccaacgttaattgtaggttttttgtgttgcaattttcaattgatttgtagaatgattaatataatcttcaac |
109 |
Q |
| |
|
||||||||| |||| ||||||||| |||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
19603216 |
attattctccgtggctttaatttccattccaaccttaattgtaggttttttgtgttgcaattt-----------gtagaatgattaatataatcttcaac |
19603128 |
T |
 |
| Q |
110 |
taattgttatctatgtttgttgcaaaggcttttggaagattaggaaattcagtgaagaaattgtctaaggttgtttcggaagaggtacctggaactttat |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19603127 |
taattgttatctatgtttgttgcaaaggcttttggaagattaggaaattcagtgaagaaattgtctaaggttgtttcggaagaggtacctggaactttat |
19603028 |
T |
 |
| Q |
210 |
cttctctcaaactttctagtttggagctcagtgatttgtcacagcaattaaacagtctcaggtaacacataattcgatcacggtttatttatcaccaaca |
309 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
19603027 |
cttctctcaaactttctagtttggagcttagtgatttgtcacagcaattaaacagtctcaggtaacacataattcgatcacggtttatttatcaccgaca |
19602928 |
T |
 |
| Q |
310 |
ttttatattgatggcgtgtcagt |
332 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
19602927 |
ttttatattgatggcgtgtcagt |
19602905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University