View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18599_low_25 (Length: 299)
Name: NF18599_low_25
Description: NF18599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18599_low_25 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 18 - 289
Target Start/End: Complemental strand, 45227887 - 45227616
Alignment:
| Q |
18 |
gttttatcaaatcataattggaatagatatataaaacattttaaattttaatatgatagatgttgtccattaagcttacctttttataacttataaggga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45227887 |
gttttatcaaatcataattggaatagatatataaaacattttaaattttaatatgatagatgttgtccattaagcttacctttttataacttataaggga |
45227788 |
T |
 |
| Q |
118 |
tcaattattggcattgcataacattccattggcactgagcttaaaatttaagatggaaacttaagataagagggacaaaacattgaccgtggatgattat |
217 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45227787 |
tcaattattggcatagcataacattccattggcactgagcttaaaatttaagatggaaacttaagataagagggacaaaacattgaccgtggatgattat |
45227688 |
T |
 |
| Q |
218 |
taaggagccaatttcaccgacaatgaatgattgtgttgttgtcatgcaaattaattgtgagctatgcctatg |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45227687 |
taaggagccaatttcaccgacaatgaatgattgtgttgttgtcatgcaaattaattgtgagctatgcctatg |
45227616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University