View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18599_low_30 (Length: 279)
Name: NF18599_low_30
Description: NF18599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18599_low_30 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 154; Significance: 1e-81; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 80 - 262
Target Start/End: Original strand, 60887 - 61079
Alignment:
| Q |
80 |
gagttatgatctatctatttaccaatttggtaatcgatttcagatctgtattgtattgtatgcaaaatgtcagatccaacttcattctctagaaagctaa |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
60887 |
gagttatgatctatctatttaccaatttggtaatcgatttcagatctgtattgtattgtatgcaaaatgtcagatccaacttcattctctagaaagctaa |
60986 |
T |
|
| Q |
180 |
ttagctaaata----------caatgcaattctaggaagtacgaatgcatacatggacattggccacactattagtattgatacgttgatact |
262 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
60987 |
ttagctaaatacaatgcaatgcaatgcaattctaggaagtacgaatgcatacacggacattggccacactattagtattgatacgttgatact |
61079 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University