View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18599_low_31 (Length: 275)
Name: NF18599_low_31
Description: NF18599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18599_low_31 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 8 - 275
Target Start/End: Complemental strand, 2944594 - 2944327
Alignment:
| Q |
8 |
cgaaaaatatagaaatactgcacaagaaagaactgctgtgctatcattagtaaagcgatactacggaactgttgtgtaatctccactcaattaaaacaga |
107 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
2944594 |
cgaaaattatagaaatactgcacaagaaagaactgctgtgctatcattagtaaagcgatactacggaactgttgtgtaatctccactcaattaaaacaca |
2944495 |
T |
|
| Q |
108 |
atagtattcctcaagagatagttatcacagtttggtatacccccttgttcatatatgttgggattaaggtgcttctcattcactttcttagagctcacat |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
2944494 |
atagtattcctcaagagatagttatcacagtttggtatacccccttgttcatatatgtagggattaaagtgcttctcattcactttcttagagctcacat |
2944395 |
T |
|
| Q |
208 |
tcttgttaaacaattttaggagctatcttatgccttcctctattagaccgtttaattcctcgatagtt |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
2944394 |
tcttgttaaacaattttaggagctatcttatgccttcctctattagatcgtttaatgcctcgatagtt |
2944327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University