View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18599_low_35 (Length: 252)
Name: NF18599_low_35
Description: NF18599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18599_low_35 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 105 - 205
Target Start/End: Complemental strand, 37606737 - 37606636
Alignment:
| Q |
105 |
aagtatttcattatcctgatttttcatacattattagcttcttcctccttctaaattttgtgactaaatttcttgtatt-aaaataggttcggaaacagc |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
37606737 |
aagtatttcattatcctgatttttcatacattattagcttcttcctccttctaaagtttgtgactaaatttcttgtattaaaaataggttcggaaacagc |
37606638 |
T |
 |
| Q |
204 |
ct |
205 |
Q |
| |
|
|| |
|
|
| T |
37606637 |
ct |
37606636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 252
Target Start/End: Complemental strand, 37606606 - 37606558
Alignment:
| Q |
206 |
cttttgcttgcatgcacaaagtgaatgt--gtgtcgaatccattaattc |
252 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
37606606 |
cttttgcttgcatgcacaaagtgaatgtgtgtgtcgaatccattaattc |
37606558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University