View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18599_low_40 (Length: 247)
Name: NF18599_low_40
Description: NF18599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18599_low_40 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 5 - 241
Target Start/End: Original strand, 33892414 - 33892641
Alignment:
| Q |
5 |
ggttgtgtatccaaataacatttcttcctaaccaatattacagggggaaaagatagaaaagatagaaaagatagaaatctacaagtctctcttagttgcc |
104 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33892414 |
ggttgtgtatccaaataacctttcttcctaaccaatattacagggggaaa---------agatagaaaagatagaaatctacaagtctctcttagttgcc |
33892504 |
T |
|
| Q |
105 |
ctcacgagcatctcttccaggacctttgcggttcaagtaccgaatgacagcatcctcaaccctgaaaatgttacaaataataacacaaataaggtaaaga |
204 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33892505 |
ctcacgagcatctcttccagcacctttgcggttcaagtaccgaatgacagcatcctcaaccctgaaaatgttacaaataataacacaaataaggtaaaga |
33892604 |
T |
|
| Q |
205 |
atataaaatcactttagcatatctttggccctatgtt |
241 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
33892605 |
atataaaatcactttagtatatctttggccctatgtt |
33892641 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University