View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18599_low_45 (Length: 238)
Name: NF18599_low_45
Description: NF18599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18599_low_45 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 38280144 - 38280384
Alignment:
| Q |
1 |
tagtccagtagtgcactgaataagttccaacttatactttgaactttgctgcctcttccattttagccttcaatagttgatttaaagagtgattggatct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38280144 |
tagtccagtagtgcactgaataagttccaacttatactttgaactttgctgcctcttccattttagccttcaatagttgatttaaagagtgattggatct |
38280243 |
T |
|
| Q |
101 |
ttgatgatagtgtggtcatgaaagtgctgtgacccacttctcttaaaatagtgaggtgaggaagcaagtt-------------------caatcaaaaaa |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
38280244 |
ttgatgatagtgtggtcatgaaagtgctgtgacccacttctcttaaaatagtgaggtgaggaagcaagttcaatatatttcatctcaaccaatcaaaaaa |
38280343 |
T |
|
| Q |
182 |
tgtgtatttagaagagggttagagagcctactgttagttag |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38280344 |
tgtgtatttagaagagggttagagagcctactgttagttag |
38280384 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University