View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18599_low_54 (Length: 208)
Name: NF18599_low_54
Description: NF18599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18599_low_54 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 16 - 190
Target Start/End: Complemental strand, 44706271 - 44706097
Alignment:
| Q |
16 |
aagaaagagatcatttacagtgaaaggaaagatgtagttgatgaattgtcacatatacactctgagaaaccttcagttggaagtacttctccaaaagagc |
115 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| | |
|
|
| T |
44706271 |
aagaaagagatcatttacagtgaaaggaaggatgtagttgatgaattgtcacatatacactctgagaaaccttcagttggaaatacttctccaaaagatc |
44706172 |
T |
 |
| Q |
116 |
ctgttaaatcaagtgatgatagtaggtttgggattatatgagacttgagttcattctcaaatctcaatccttaac |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44706171 |
ctgttaaatcaagtgatgatagtaggtttgggattatatgagacttgagttcattctcaaatctcaatccttaac |
44706097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University