View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1859_high_8 (Length: 247)
Name: NF1859_high_8
Description: NF1859
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1859_high_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 104; Significance: 6e-52; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 109 - 243
Target Start/End: Original strand, 28035142 - 28035276
Alignment:
| Q |
109 |
agtatatattaaatcaatggaatcctctggtacctcttgattgataaagttccaacctacttttggcttctggtaaaattgcttgaannnnnnnnnctgc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||| |
|
|
| T |
28035142 |
agtatatattaaatcaatggaatcctctggtacctcttgattgataaagttccaacctacttttggcttctggtaaaattgcttcaatttttttttctgc |
28035241 |
T |
 |
| Q |
209 |
cattatatgtgtttgctttgtgcaccactcaagta |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
28035242 |
cattatatgtgtttgctttgtgcaccactcaagta |
28035276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 125 - 179
Target Start/End: Complemental strand, 8758077 - 8758023
Alignment:
| Q |
125 |
atggaatcctctggtacctcttgattgataaagttccaacctacttttggcttct |
179 |
Q |
| |
|
|||||||||||| | |||||| || |||||||| ||||||||||| ||||||||| |
|
|
| T |
8758077 |
atggaatcctcttgaacctctagactgataaagctccaacctactcttggcttct |
8758023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University