View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1859_low_13 (Length: 211)
Name: NF1859_low_13
Description: NF1859
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1859_low_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 197
Target Start/End: Complemental strand, 2752372 - 2752176
Alignment:
| Q |
1 |
tacgacaaaaatcccaccacgtgtgaaaccataatcagacaaagatttcagtgttggattcttaaaattgaatcagttattgtaacttgtaatctaagtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
2752372 |
tacgacaaaaatcccaccacgtgtgaaaccataatcagacaaagatttcagtgttggattcttaaaattgaatcagttattgtaacttgtaagctaagtt |
2752273 |
T |
 |
| Q |
101 |
tgacttcaactataacccttcagttattctcttctcatctcaggttttagcatgacccctgaaacaatcggtcaacaaaaatctgtgtttgattttt |
197 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2752272 |
tcacttcaactataacccttcagttattctcttctcatctcaggttttagcatgacccctgaaacaatcggtgaacaaaaatctgtgtttgattttt |
2752176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 38 - 71
Target Start/End: Complemental strand, 2752406 - 2752373
Alignment:
| Q |
38 |
gacaaagatttcagtgttggattcttaaaattga |
71 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
2752406 |
gacaaagatttcagcgttggattcttaaaattga |
2752373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University