View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18600_high_31 (Length: 250)

Name: NF18600_high_31
Description: NF18600
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18600_high_31
NF18600_high_31
[»] chr7 (1 HSPs)
chr7 (14-250)||(46892426-46892662)


Alignment Details
Target: chr7 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 14 - 250
Target Start/End: Original strand, 46892426 - 46892662
Alignment:
14 ttctcaatcactcttccctattgcacttcttaccaactcatccgtccacgtcatcatgtactcttactacttcctcaccaccgttggtatccgaccgcct 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
46892426 ttctcaatcactcttccctattgcacttcttaccaactcatccgtccacgtcatcatgtactcttactacttcctcaccaccgttggaatccgaccgcct 46892525  T
114 tggaaacgcgtcgttaccgactgccagattgttcagttcgtgttcagcttcgccgtctccggtctcatgctttattatcacttcggatccgatggtggtg 213  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46892526 tggaaacgcgtcgttaccgactgccagattgttcagttcgtgttcagcttcgccgtctccggtctcatgctttattatcacttcggatccgatggtggtg 46892625  T
214 gatgctctgggatgaaggcttggtgtttcaatgctgt 250  Q
    |||||| ||||||||||||||||||||||||||||||    
46892626 gatgctgtgggatgaaggcttggtgtttcaatgctgt 46892662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University