View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18600_high_39 (Length: 232)
Name: NF18600_high_39
Description: NF18600
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18600_high_39 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 12 - 213
Target Start/End: Complemental strand, 14791460 - 14791252
Alignment:
| Q |
12 |
agcaaaggtcaagtaaaaggagaataattccaccac-------agtgagaatatgatttgtgatcaaagcgtgggttctgtttcatccagcgatgccaat |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14791460 |
agcaaaggtcaagtaaaaggagaataattccaccacgtccagtagtgagaatatgatttgtgatcaaagcgtgggttctgtttcatccagcgatgccaat |
14791361 |
T |
 |
| Q |
105 |
ggctggcataatgtgatcgttctttcaaaagtatactagttattttagtagagttttcttaaactttcattgcaattatcccttttattttactattgga |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14791360 |
ggctggcataatgtgatcgttctttcaaaagtatactagttattttagtagagttttcttaaactttcattgcaattatcccttttattttactattgga |
14791261 |
T |
 |
| Q |
205 |
tgtaagtat |
213 |
Q |
| |
|
||||||||| |
|
|
| T |
14791260 |
tgtaagtat |
14791252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University