View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18600_low_26 (Length: 276)
Name: NF18600_low_26
Description: NF18600
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18600_low_26 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 16 - 266
Target Start/End: Complemental strand, 39664727 - 39664476
Alignment:
| Q |
16 |
agttacaccgccaatttgtcataatcattggatcactaaaaatatt-cacttcaatcatatttaacttttatacaggaatgcgtgaggggagctctaaaa |
114 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39664727 |
agttacaccaccaatttgtcataatcattggatcactaaaaatatttcacttcaatcatatttaacttttatacaggaatgcgtgaggggagctctaaaa |
39664628 |
T |
 |
| Q |
115 |
ggaaagaccattgttcttgtaacacaccaagtagacttcttacataatgtggatcgtattgtggtaagtctcttttattcaatcatgtgtgtgattcttg |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
39664627 |
ggaaagaccattgttcttgtaacacaccaagtagacttcttacataatgtggatcgtattgtggtaagtctctctttttcaatcatgtgtgtgattcttg |
39664528 |
T |
 |
| Q |
215 |
gtgaatgaggagttctaacatgtatatatatttgtttgcaaataggtgatga |
266 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39664527 |
gtgaatgacgagttctaacatgtatatatatttgtttgcaaataggtgatga |
39664476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University