View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18600_low_27 (Length: 268)
Name: NF18600_low_27
Description: NF18600
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18600_low_27 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 3 - 253
Target Start/End: Original strand, 6444604 - 6444851
Alignment:
| Q |
3 |
ttacaccttctcttccctttatgtctgctgtcccactaacgattttgtgtgtgtacgaaatagactgtagtagtaggttaggttctattactatcatttc |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6444604 |
ttacaccttctcttccctttatgtctgctgtcccactaacgattttgtgtgtgtacgaaatagactgtagtagtaggttaggttctattactatcatttc |
6444703 |
T |
|
| Q |
103 |
ttttcgttttcaaactttctaaatctttcatcatagtcaacatttcaagcttatctaattggaattcgtgtgcagaagcacaagatcaatttcttgttca |
202 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
6444704 |
ttttcgttttgaaactttctaaatctttcatcatagtcaacatttcaagcttatctaattggaattggtgtgcagaagcacaa---taatttcttgttca |
6444800 |
T |
|
| Q |
203 |
caattttaaaccaaccaattgtggaatttgcatgtgattatcatatatata |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6444801 |
caattttaaaccaaccaattgtggaatttgcatgtgattatcatatatata |
6444851 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University