View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18600_low_28 (Length: 267)
Name: NF18600_low_28
Description: NF18600
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18600_low_28 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 248
Target Start/End: Complemental strand, 33787092 - 33786845
Alignment:
| Q |
1 |
cacagaatcatgaactattcattgattttctctgctttgtcggttgcttctattacactcaatctctttcaacactacaattttgcttatatgggagcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33787092 |
cacagaatcatgaactattcattgattttcactgctttgtcggttgcttctattactctcaatctctttcaacactacaattttgcttatatgggagcaa |
33786993 |
T |
|
| Q |
101 |
agttaacgaaaaggataaggttgtgtatgttggaaaagatattaacctttgaaactgcttggtttgatgaggnnnnnnnctctagtggagcattatgttc |
200 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
33786992 |
agttaacgaaaaggataaggctgtgtatgttggaaaagatattaacctttgaaactgcttggtttgatgaggaaaaaaactctagtggagcattatgttc |
33786893 |
T |
|
| Q |
201 |
aaggttgagtaacgaagcttcgatggtgaaatcgctcgttgctgatag |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33786892 |
aaggttgagtaacgaagcttcgatggtgaaatcgctcgttgctgatag |
33786845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University