View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18600_low_31 (Length: 250)
Name: NF18600_low_31
Description: NF18600
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18600_low_31 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 16 - 250
Target Start/End: Original strand, 11775764 - 11776002
Alignment:
| Q |
16 |
atgatcaccaaaattcagaggctgagtcatctatttctactgatgaaccaaatgaatctggtgaaagagtgaatttgagaaagcgtccaaggaaaagcac |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11775764 |
atgatcaccaaaattcagaggctgagtcatctatttctactgatgaaccaaatgaatctggtgaaagagtgaatttgagaaagcgtccaaggaaaagcac |
11775863 |
T |
 |
| Q |
116 |
tcctataagatctatctctagttttgtaaatgattattgaaatttttcaattttctc----ttctttcttgattatattatttgcttatatactaggtga |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
11775864 |
tcctataagatctatctctagttttgtaaatgattattgaaatttttcaattttctcttctttctttcttgatcatattatttgcttatatacttggtga |
11775963 |
T |
 |
| Q |
212 |
ataaggtttattgcaactttttagaaacacaagttcatt |
250 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
11775964 |
ataagatttattgcaacgttttagaaacacaagttcatt |
11776002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University