View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18600_low_35 (Length: 240)
Name: NF18600_low_35
Description: NF18600
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18600_low_35 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 12 - 165
Target Start/End: Original strand, 11776006 - 11776159
Alignment:
| Q |
12 |
acataataagaaattaatttcatgtataaattgggtgtttatggtccattaagctttgatatgagtggtgcaaaaatggtcaaatgattgttttaaacca |
111 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11776006 |
acataataagaaattaatttcatgtataagttgggtgtttatggtccatttagctttgatatgagtggtgcaaaaatggtcaaatgattgttttaaacca |
11776105 |
T |
 |
| Q |
112 |
aacatatattatatgatttgcatatgcatgatgaacatgcatagtactcattac |
165 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
11776106 |
aacatatattatatcatttgcatatgcatgatgtacatgcatagtactcattac |
11776159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 181 - 225
Target Start/End: Original strand, 11776181 - 11776225
Alignment:
| Q |
181 |
aatctagtacctattttgcattttcttctaggattcccaaaatct |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11776181 |
aatctagtacctattttgcattttcttctaggattcccaaaatct |
11776225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University