View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18600_low_36 (Length: 240)
Name: NF18600_low_36
Description: NF18600
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18600_low_36 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 2762286 - 2762512
Alignment:
| Q |
1 |
aatcttttatggatatacaacaaatttatatagtctcnnnnnnngtaatacctgtgtggtctttttaagacaaaatattgtaagaattgcgcttgtacga |
100 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2762286 |
aatcttttatggatatacaacaaatctatatagtctctttttttgtaatacctgtgtggtctttttaagacaaaatattgtaagaattgcgcttgtacga |
2762385 |
T |
|
| Q |
101 |
gttaccattgtcttttttggtacattaccattgtcctctagctgtctagcatattagtaaatgacacctcaaaatattgcaaatgagcaaccagtaacca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
2762386 |
gttaccattgtcttttttggtacattaccattgtcctctagctgtctagcatattagtaaatgacacctcaaaatattgcaaatgaccaaccagtaacca |
2762485 |
T |
|
| Q |
201 |
ctaaaatacattagatccaaattagtg |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
2762486 |
ctaaaatacattagatccaaattagtg |
2762512 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University