View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18600_low_37 (Length: 238)
Name: NF18600_low_37
Description: NF18600
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18600_low_37 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 15 - 222
Target Start/End: Complemental strand, 25179448 - 25179241
Alignment:
| Q |
15 |
ggattagtcatgagttgatggaaagtgctaaggaagtttggcgtgagttctttaaccttccacttgaagtgaaggaagaatttgctaactctcctagtac |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25179448 |
ggattagtcatgagttgatggaaagtgctaaggaagtttggcgtgagttctttaaccttccacttgaagtgaaggaagaatttgctaactctcctagtac |
25179349 |
T |
|
| Q |
115 |
ttatgagggttatggtagtaggttgggagtgaaaaaaggtgctattttggattggagtgactacttttttcttcattctatgcctccttctcttaggaac |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25179348 |
ttatgagggttatggtagtaggttgggagtgaaaaaaggtgctattttggattggagtgactacttttttcttcattctatgcctccttctcttaggaac |
25179249 |
T |
|
| Q |
215 |
caagctaa |
222 |
Q |
| |
|
|||||||| |
|
|
| T |
25179248 |
caagctaa |
25179241 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 90; Significance: 1e-43; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 18 - 191
Target Start/End: Original strand, 4776809 - 4776982
Alignment:
| Q |
18 |
ttagtcatgagttgatggaaagtgctaaggaagtttggcgtgagttctttaaccttccacttgaagtgaaggaagaatttgctaactctcctagtactta |
117 |
Q |
| |
|
|||||||||| |||||| || |||||| |||||||||||||||||| ||| | || |||||||| ||||| || || | |||||| ||||||| ||||| |
|
|
| T |
4776809 |
ttagtcatgacttgatgaaacgtgctagggaagtttggcgtgagttttttgaactaccacttgaggtgaaagaggagtatgctaattctcctaccactta |
4776908 |
T |
|
| Q |
118 |
tgagggttatggtagtaggttgggagtgaaaaaaggtgctattttggattggagtgactacttttttcttcatt |
191 |
Q |
| |
|
|||||| ||||| ||| | |||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
4776909 |
tgagggatatggaagtcgtttgggagtgaaaaaaggtgccattttggattggagtgactacttttttcttcatt |
4776982 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University