View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18600_low_45 (Length: 203)
Name: NF18600_low_45
Description: NF18600
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18600_low_45 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 20 - 184
Target Start/End: Complemental strand, 31853772 - 31853608
Alignment:
| Q |
20 |
agctagactaacaagtgtgtattaaagaactttctcgtacagtgtcttgctggcttttgtgcatatcaactatttttccacatggtaacaattcccacta |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
31853772 |
agctagactaacaagtgtgtattaaagaactttctcgtacagtgtcttgctggcttttgtgcatatcaactatttttccacatggtaacaattcccgcta |
31853673 |
T |
|
| Q |
120 |
tgttaattcatcataagacacgtacattaacacatgtccccctgcatgtttttgccatatacccc |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31853672 |
tgttaattcatcataagacacgtacattaacacatgtccccctgcatgtttttgccatatacccc |
31853608 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University