View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18601_high_6 (Length: 329)
Name: NF18601_high_6
Description: NF18601
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18601_high_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 69; Significance: 6e-31; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 240 - 308
Target Start/End: Complemental strand, 17990924 - 17990856
Alignment:
| Q |
240 |
gaaattcttcttgtcatcaacacccttaccagttgaacttactgcatgtgctggaagatttgcatgcac |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17990924 |
gaaattcttcttgtcatcaacacccttaccagttgaacttactgcatgtgctggaagatttgcatgcac |
17990856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 1 - 36
Target Start/End: Complemental strand, 2223397 - 2223362
Alignment:
| Q |
1 |
agtcaccacaattcgccactacaacctcctccttcc |
36 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |
|
|
| T |
2223397 |
agtcaccacaattcgccactacaatctcctccttcc |
2223362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University