View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18601_high_6 (Length: 329)

Name: NF18601_high_6
Description: NF18601
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18601_high_6
NF18601_high_6
[»] chr1 (1 HSPs)
chr1 (240-308)||(17990856-17990924)
[»] chr5 (1 HSPs)
chr5 (1-36)||(2223362-2223397)


Alignment Details
Target: chr1 (Bit Score: 69; Significance: 6e-31; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 240 - 308
Target Start/End: Complemental strand, 17990924 - 17990856
Alignment:
240 gaaattcttcttgtcatcaacacccttaccagttgaacttactgcatgtgctggaagatttgcatgcac 308  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
17990924 gaaattcttcttgtcatcaacacccttaccagttgaacttactgcatgtgctggaagatttgcatgcac 17990856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 1 - 36
Target Start/End: Complemental strand, 2223397 - 2223362
Alignment:
1 agtcaccacaattcgccactacaacctcctccttcc 36  Q
    |||||||||||||||||||||||| |||||||||||    
2223397 agtcaccacaattcgccactacaatctcctccttcc 2223362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University