View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18602_low_19 (Length: 291)
Name: NF18602_low_19
Description: NF18602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18602_low_19 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 1 - 284
Target Start/End: Original strand, 3310861 - 3311146
Alignment:
| Q |
1 |
tcaactcaacagagagagaaagacatgcaacacgtggatagggcatgtcatcagatctcgttaaa--ctgatgattgatatgtgaggatagagaggagaa |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| | ||||||||||||||||||||||||| |
|
|
| T |
3310861 |
tcaactcaacagagagagaaagacatgcaacacgtggatagggcatgtcatcagatctcgttaaaaactgataactgatatgtgaggatagagaggagaa |
3310960 |
T |
|
| Q |
99 |
atgagtgctgctgcttttgcagattgaactataaactaggtctgagtgagagggttttcaactgtaaaaatatcttcataaatgacaaatatgaggcttg |
198 |
Q |
| |
|
||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3310961 |
atgagtgttgctgcttttgcagattgcactataaactaggtctgagtgagagggttttcaactgtaaaaatatcttcataaatgacaaatatgaggcttg |
3311060 |
T |
|
| Q |
199 |
gacatggagcagccttttgtacatgttgtgtgtggcgtgtgtgagaggtcaagaaagagacactactcttaaatgctcctttgctt |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3311061 |
gacatggagcagccttttgtacatgttgtgtgtggcgtgtgtgagaggtcaagaaagagacactactcttaaatgctcctttgctt |
3311146 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University