View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18602_low_23 (Length: 242)
Name: NF18602_low_23
Description: NF18602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18602_low_23 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 24 - 226
Target Start/End: Original strand, 39026477 - 39026679
Alignment:
| Q |
24 |
ggtacatgtaaacccttttctcttagggactgtttggcagctgaacatagcaaagaaattatcttgcataatttgttctctctcccaataaagattaatg |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
39026477 |
ggtacatgtaaacccttttctcttagggactgtttggcagctgaacatagcaaagaaattatcttgcataatttgttctctctcccaacaaagattaatg |
39026576 |
T |
|
| Q |
124 |
gtaatgagtctattaattctttgtagtattgtgttggccttgcaagttcaaattgggacttaaagtctatatctactataagcctcataggatcatcaat |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39026577 |
gtaatgagtctattaattctttgtagtattgtgttggccttgcaagttcaaattgggacttaaagtctatatctactataagcctcataggatcatcaat |
39026676 |
T |
|
| Q |
224 |
att |
226 |
Q |
| |
|
||| |
|
|
| T |
39026677 |
att |
39026679 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University