View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18602_low_27 (Length: 216)
Name: NF18602_low_27
Description: NF18602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18602_low_27 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 19 - 207
Target Start/End: Complemental strand, 49170758 - 49170570
Alignment:
| Q |
19 |
gcttcagcattgccccaagcttcaaattcttcttattctgaaggtttcttatgtttgtggattgattttgttccttctttactttgactgtagttcacaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
49170758 |
gcttcagcattgccccaagcttcaaattcttcttattctgaaggtttcttatgtttgtggattgtttttgttccttctttactttgactgtagttcacaa |
49170659 |
T |
 |
| Q |
119 |
atcttatttttgtatatgttttgcagttatcagaggacaaaataaactggaaatacccaaattttgttcctgaatgcatttcatctcac |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49170658 |
atcttatttttgtatatgttttgcagttatcagaggacaaaataaactggaaatacccaaattttgttcctgaatgcatttcatctcac |
49170570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 59 - 207
Target Start/End: Original strand, 49179408 - 49179556
Alignment:
| Q |
59 |
aaggtttcttatgtttgtggattgattttgttccttctttactttgactgtagttcacaaatcttatttttgtatatgttttgcagttatcagaggacaa |
158 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||| | ||| ||||| |
|
|
| T |
49179408 |
aaggtttcttatgtttgtggattgtttttgttccttctttacttcgactgtatttcacaaatcttatttttgtatatgttttgcagctgtcacccgacaa |
49179507 |
T |
 |
| Q |
159 |
aataaactggaaatacccaaattttgttcctgaatgcatttcatctcac |
207 |
Q |
| |
|
|| || ||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
49179508 |
tattaattggaaatacccaaattttgttcctgaatgcatttcgtctcac |
49179556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University