View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18603_high_13 (Length: 266)
Name: NF18603_high_13
Description: NF18603
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18603_high_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 126; Significance: 5e-65; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 1 - 149
Target Start/End: Original strand, 16778976 - 16779125
Alignment:
| Q |
1 |
aatgagaaacatgcagatcaggaaaagacaaaacaaattcaccactattgttggagcgaccacatgttccgcagctaaaccta-cccatcatgtgccttg |
99 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
16778976 |
aatgagagacatgcagatcaggaaaagacaaaacaaattcaccactattgtggaagcgaccacatgttccgcagctaaacctaccccatcatgtgccttg |
16779075 |
T |
 |
| Q |
100 |
tgtcagatgcaatgttgtgctgtttctgcttccttcctgcatgaattttt |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
16779076 |
tgtcagatgcaatgttgtgctgtttctgcttccttcctgcatgacttttt |
16779125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University